Library construction and whole-genome resequencing The amplified DNA fragment was digested with the restriction enzymes PstI and SalI, and then cloned into the vector plasmid pLB-Dblet to construct pSur2: Forward: TAGCTGCAGCAAGTGTCCTTCGTAGTCGC Reverse: TCAGTCGACGTCACGTCTGTCACCACCAG. Two oligonucleotides were used to amplify the sur2 + gene region. To overexpress wild-type Sur2, pSur2 plasmid was constructed. After SDS polyacrylamide gel electrophoresis, the amounts of Sur2 or Sur2-L1 protein were detected with anti-GST antibody (Santa Cruz Biotechnology, Dallas, Texas, U.S.A.). At the logarithmic growth phase, cells were collected and cell lysates were prepared. Strains Sur2-GST ( h – leu1-32 ade6-M216 sur2-GST::kan R) and Sur2-L1-GST ( h – leu1-32 ade6-M216 sur2-L1-GST::kan R) were grown in SD medium.
#FISSION YEAST SERIAL#
For caffeine or KCl sensitivity tests, logarithmic growth phase cells were spotted in serial dilutions onto YE plates containing 1 M KCl or 10 mM caffeine and the plates were incubated at 30☌ for 3 days. For caloric restriction (CR) experiment, SD low glucose medium (SD medium containing 0.5% glucose) was used. Analysis of viability was performed as described previously (Ohtsuka et al. SD medium or YE medium with standard amounts of the components necessary for growth were used for the cultivation at 30☌. Oligonucleotides were used and DNA fragments amplified by PCR were used to transform JY333 and L1 mutant by electroporation: F1: CTTCATCATTGACAGCTGGC F2: TTAATTAACCCGGGGATCCGGTTAACCTTCTTTGCATTCTTAGCC R1: CTGACTTATGCGACCTCGAC R2: GTTTAAACGAGCTCGAATTCGGTAGTACAAATCGATTGGC. The GST cassette from pFA6a-GST-kanMX6 was used to produce the Sur2-GST and Sur2-L1-GST strains (Bähler et al. The following oligonucleotides were used to transform the L1 mutant by electroporation with DNA fragments amplified by PCR: F1: CTTCATCATTGACAGCTGGC F2: TTAATTAACCCGGGGATCCGTAAAACGCGTCTACGATACC R1: CTGACTTATGCGACCTCGAC R2: GTTTAAACGAGCTCGAATTCTAACTTACTGTAAACACGGG. Schizosaccharomyces pombe strain HM3802 ( h + leu1-32 ade6-M210) was used for backcrossing, and the JY333 sur2-L1::kan R strain was generated using the kan R cassette derived from pFA6a-kanMX6 (Bähler et al. Schizosaccharomyces pombe strain JY333 ( h - leu1-32 ade6-M216) was used for mutant screening. We therefore searched for and characterized lifespan extending mutant of S. Since lifespan is thought to be intricately regulated by many factors, and factors important for lifespan regulation are conserved in eukaryote, understanding lifespan regulation requires the identification of new factors that affect lifespan at different stages. 2017) and those involved in cell surface structure (Oshiro, Aiba and Mizuno 2003 Fujita et al. These variants can be broadly classified into those involved in glucose utilization (Ito et al. In order to understand the mechanisms controlling chronological lifespan, we have identified and analyzed several mutants that exhibit long- or short-lived phenotype in fission yeast. Information on factors involved in the regulation of lifespan in fission yeast has been accumulated (Ohtsuka, Shimasaki and Aiba 2020). In Schizosaccharomyces pombe, Pka1 and Sck2 are regulators of chronological lifespan, with mutants of each showing a long-lived phenotype, and double mutant of pka1 and sck2 having an additive effect on chronological lifespan, suggesting that these two factors regulate related but independent pathways (Roux et al. In higher eukaryotes, a similar pathway (insulin/IGF-I-like) regulates lifespan, suggesting a common evolutionary origin for lifespan regulation (Longo and Fabrizio 2002 Longo and Kennedy 2006). Downregulation of either pathway promotes lifespan extension. In Saccharomyces cerevisiae, the PKA pathway and the Sch9 pathway have been identified that control chronological lifespan (Fabrizio et al. In yeast, the chronological lifespan is defined as the period during which the cell maintains viability after entering stationary phase (Roux et al. Lifespan, Schizosaccharomyces pombe, aging, sphingolipid hydroxylase, Sur2, yeast INTRODUCTION
0 kommentar(er)
